Detection Rate of Metallo-β-Lactamase-Expressing Genes; blaVIM-1, blaVIM-2 and blaSPM-1 in Pseudomonas aeruginosa Isolates

Introduction

Pseudomonas aeruginosa is broadly recognized as an opportunistic aggressor rather than a cause of early infection in healthy persons.¹ It constitutes around 10%-20% of hospital-acquired infections in intensive care units (ICUs), cystic fibrosis, respiratory and renal infections, and body surface infections.² Multidrug-resistant mechanisms of P. aeruginosa include expression of efflux pumps, production of biofilms, and secretion of resistance-inducing enzymes such as β-lactamases and aminoglycosidases.³ This bacterium is a concerning issue considering antimicrobial chemotherapy.⁴

Enzyme production is a prominent β-lactam resistance mechanism in P. aeruginosa. Penicilloyl-serine transferases separate the amide bond of the β-lactamase ring removing the antibacterial activity (5). β-lactamases have been recently classified in 2 ways: the molecular and the functional. Regarding the molecular classification, several categories of β-lactamases have been identified; these are known as class A, B, C and D. Enzymes belonging to the classes A, C and D use serine amino acid for their activity, while enzymes of class B are dependent on divalent cations for their activity.¹ On the basis of molecular features, metallo-β-lactamases (MBLs) are comprised of the following 6 groups: IMP, VIM, SIM, SPM, GIM, and AIM.⁶ Carbapenems resistances may result from decreased outer membrane permeabil­ity, exclusion from the cell by efflux pumps, changes of penicillin-binding protein, and production of β-lactamase.⁷

Carbapenems are currently used for the treatment of Pseudomonas infections. Resistance genes such as MBLs can easily be tramsitted by genomic compartments shuch as plasmids and calss I integrons, and this may be a source of dissemination of antibiotic resistance throughout the clinics.^8,9 MBLs can intensely hydrolyze all betalactam antibiotics except azetreonam. These enzymes need zinc as cofactor.¹⁰ Sulbactam, tazobactam, and clavulanic acid which are often used to inhibit betalactamase enzymes are not useful against MBLs.^11,12 Due to our limitation in providing efficient antibiotic alternatives in cases of resistant organisms, the presence of MBL in clinical isolates of P. aeruginosa were investigated. In addition, prolonged hospitalization and high fatality rates have been associated with MBL positive P. aeruginosa infections. The aim of this study was to investigate the antibiotic resistance profile and the prevalence of blaVIM-1, blaVIM-2 and blaSPM-1 genes encoding MLBs among clinical isolates of P. aeruginosa obtained from Afzalipour and Bahonar hospitals of Kerman city, by double disk synergy test (DDST) and multiplex polymerase chain reaction (PCR).

Methods

In the present cross-sectional study, 60 suspected isolates of Pseudomonas were collected out of 234 examined isolates obtained from hospitalized patients in Kerman, Iran, during 2014-2015. These bacteria had been recovered from several nosocomial samples such as urine, wound, blood, trachea and other clinical samples. The colonies were again cultured in MacConkey agar medium and pure colonies were recognized as P. aeruginosa according to Gram staining and bacteriological tests such as oxidase, catalase, oxidative-fermentative test, growth on media such as TSI, SIM, cetrimide agar (Merk, Germany) and growth at 42°C. Isolates were conserved in Trypticase soy broth media (TSB) including 20% glycerol and stored at -70°C until use.¹³

DNA Extraction and PCR Reaction

For DNA extraction, boiling assay was used. Colonies were extracted from cetrimide agar and were incubated at 37^∘C for 16 hours. The bacterial precipitate was dissolved in 500 𝜇L distilled water, and the bacteria in the mixture were heated at 100^∘C for 10 minutes, and then centrifuged at 13 000×g (10 minutes, room temperature). The supernatant containing DNA was collected into a new micro tube.¹² PCR reaction for diagnosis of MBL genes was accomplished in Mastercycler Eppendorf (Eppendorf, Germany) and in final volume of 25 𝜇L including PCR Buffer (10x, 2.5𝜇L) (CinnaGen, Iran), MgCl₂ (50mM, 1 𝜇L) (CinnaGen, Iran), dNTPs (10mM, 1 𝜇L) (CinnaGen, Iran), forward and reverse primers (10 pmol/𝜇L, 1 𝜇L each), Taq DNA polymerase (50 U/𝜇L, 1 𝜇L) (CinnaGen, Iran), DNA (2 𝜇L), and distilled water (15.5 𝜇L). P. aeruginosa PO510 (Pasargad Research Laboratory) producing blaVIM-1 and P. aeruginosa 16 producing blaSPM-1 were applied as the positive controls, while P. aeruginosa ATCC 27853 served as the negative control. The amplicons were analyzed by 1% (w/v) agarose gel electrophoresis and stained with ethidium bromide and visualized on gel documentation (Bio Rad‏، USA) (Figure 1). Primer sequences were designed using the NCBI Primer BLAST database. Primers sequences used for detection of MBL genes and PCR temperature profile for amplification of MBL genes are shown in Tables 2 and 3, respectively. For the statistical analyses, SPSS software version 19.0 was applied.

Figure 1. Gel Electrophoresis of PCR Products Following Amplification With Specific Primers for blaVIM-1, blaVIM-2, and blaSPM-1 Genes.

Lanes: M, 100 bp DNA ladder; +, positive control; -, negative control; 25-36, clinical isolates‏.

Table 2. Specific Primers Used for Detection of blaSPM-1, blaVIM-1, and blaVIM-2 and Lengths of the PCR Products
Target Gene	Primer Sequences	Amplicon Size (bp)	Tm
blaSPM-1	F: 5 CCTACAATCTAACGGCGACC 3 R: 5 TCGCCGTGTCCAGGTATAAC 3	786	58.15 59.54
blaVIM-1	F: 5 TTATGGAGCAGCAACCGATGT 3 R: 5 CAAAAGTCCCGCTCCAACGA 3	920	60.07 60.88
blaVIM-2	F: 5 AAAGTTATGCCGCACTCACC 3 R: 5 TGCAACTTCATGTTATGCCG 3	865	58.83 57.08

Table 3. PCR Programs for Amplification of MBL Genes
Target Gene	First Denaturation	Denaturation	Annealing	Extension	Numebr of Cycles	Final Extension
blaSPM-1	95°C 5 min	95°C 1min	40°C 1min	68°C 1min	30	68°C 5min
blaVIM-1 and blaVIM-2	94°C 3 min	94°C 1min	55°C 1min	72°C 2min	35	72°C 7min

Results

The samples were taken from urine (n = 24, 40%), blood (n = 4, 6.6%), wound (n = 9, 15%), tracheal aspirate (n = 12, 20%), and other sources (n = 11, 18.3%). Thirty-three (66.66%) out of 60 isolates were multidrug resistant (MDR). PCR analysis was performed for all the P. aeruginosa iso­lates. The isolates demonstrated major resistance to carbencillin (73.3%), tobramycin (78.3%), and cefotizoxime (75%) (Table 1). Of 28 imipenem-resistant strains, 17 (60.7%) were positive for MBL as displayed with DDST. blaVIM-1 and blaVIM-2 genes were not detected, while blaSPM gene was positive in 8 (28.5%) of the imipenem-resistant isolates. Table 1 displays the data for susceptibility testing of 60 P. aeruginosa clinical isolates.

Discussion

Carbapenems are effective β-lactam antibiotics for drastic cure of infections caused by Gram-negative bacteria.¹⁵ Among β-lactamases, imipenem is the chosen antibiotic for fighting against this bacterium, however P. aeruginosa can disintegrate this antibiotic through MBL enzyme.¹⁶ The rate of imipenem-resistant isolates (46.4%) in our study indicated a menace regarding therapy alternatives in our clinics. Imipenem and meropenem are commonly used antibiotics for the treatment of hospital-acquired infec­tions; nevertheless, enhanced resistance against these agents has restricted their success.¹⁷

In our results, among 28 imipenem-resistant strains, 17 (60.7%) were positive for production of MBL as shown by DDST. Kalantar et al¹⁸exhibited that 22% of the imipenem-resistant P. aerugi­nosa isolates were MBL-positive and 8 strains (8%) were positive for blaVIM1 as proved by PCR. Sarhangi et al¹⁹ assessed 240 P. aeruginosa clinical isolates; 19 (23.17%) of imipenem-resistant isolates were MBL positive as were investigated by DDST. Aghamiri et al²⁰ detected that 70 (70%) of imipenem-resistant P. aeruginosa expressed MBLs. PCR methods revealed that 70 (33%) of these strains contained the blaVIM gene.²⁰ Based on DDST test, MBL was detected in 36 (87.8%) of the P. aeruginosa isolates as studied by Doosti et al. Among 41 imipenem-resistant isolates investigated by PCR, 23 (56%) isolates harbored blaVIM gene.²¹ The variation seen between the results of our study and those of the previous reports may be due to the diversity in geographical areas, diversity in sorts of the diseases, the increased consumption of antibiotics, or diversity in antibiotic treatment abstinence.

Some MBL encoding genes have been mapped as mobile genes with possibility of transmission between organisms.¹⁶ The most prevalent, introduced families are IMP, VIM, GIM, SPM, and SIM.¹ In our study, 60.7% of the total 60 P. aeruginosa isolates were MBL producer, which were more than the outbreak of MBL producers in Egyptian studies (27% and 32.3%) and Indian study (28.57%).¹ VIM enzymes were also most prevalent in Korea (88%) and Greece (85%).²² Previous studies demonstrated that IMP and VIM producer genes of MBLs were also common in Asian studies.^23-25 VIM type was also highly prevalent in Turkey.²⁶ In previous studies in Egypt and Taiwan, VIM-2 demonstrated the highest outbreak among imipenem-resistant P. aeruginosa strains.^1,27 Since most of the integrones harbored VIM-1 gene code for aminoglycosides destructing enzymes, the matter is of clinical importance.²⁸

In the present study, SPM was the commonest (28.5%) gene detected among imipenem-resistant P. aeruginosa isolates. The other MBL genes were not identified. MBL producer imipenem resistant isolates that were negative for the MBL genes may benefit from other resistant genes like IMP, SIM, NDM GIM or other resistance mechanisms to carbapenem. Identifying the MBL non-producer isolates with DDST that expressed the MBL genes may indicate low sensitivity of our phenotyoic assay. The imipenem resistant isolates negative for MBL genes may also have other mechanisms associated with carbapenem resistance (such as AmpC β-lactamase expression, or using membrane efflux pathways).

SPM is a widespread MBL gene among the P. aeruginosa strains; nevertheless, other low frequency enzymes have also been detected.^29-32 SPM carbapenemase represents a major mechanism responsible for resistance to ceftazidime on ceftazidime-resistant P. aeruginosa isolates.³⁰ Zavascki et al identified 86 MBL producing strains, 16.27% of which expressed the blaSPM gene,³³ and Graf et al also discovered the blaSPM gene in 13.51% strains that were only susceptible to polymyxin B.³⁴ Our data are in accordance with these studies regarding high prevalence of SPM among P. aeruginosa isolates. The results of Moosavian et al study on 122 imipenem resistant P. aeruginosa isolates showed that only 2 isolates (1.6%) contained blaVIM-2 gene, whereas none of them were positive for blaSPM-1.¹³ Sarhangi et al¹⁹ discovered that 12.1% of imipenem-resistant P. aeruginosa isolates expressed blaVIM-2 gene, while no occurrence of blaSPM1 was found. In the study of Ghamgosha et al,³⁵ 77.7% of MBL producing P. aeruginosa had VIM-1 gene, with no SPM-1 gene detected. Concurrent resistance to imipenem and meropenem may propose carbapenem resistance mechanisms other than the enzymatic pathway (such as porin loss and/or upregulation of efflux pumps).³⁰ High resistance to carbapenems and ceftazidime has been conferred to MBL production.³⁶ Current studies corroborate this propensity.^29,30,37,38 Resistance to other antimicrobial agents has decreased the alternative treatments for managing multidrug-resistant P. aeruginosa.^38,39 Widespread strains of the drug-resistant P. aeruginosa strains express either IMP or VIM-type genes that encode MBL. These are significant general health issues menacing the success of antimicrobial chemotherapy.

The limitation of this study was low number of the isolated P. aeruginosa strains compared to some other studies, and the strength was the use of DDST and molecular detection of the isolates.

Conclusion

We propose applying powerful superintendence and intransigent infection controlling strategies to control infectious diseases. A controlled antibiotic usage should be considered to prevent the distribution of antibiotic resistance genes among hospital pathogens.

Ethical Approval

The informed consent was obtained from the patients before using their samples, and the data were kept confidential.

Competing Interests

Authors declare that they have no competing interests.

Acknowledgments

The authors would like to express their gratitude to Pasargad Research Laboratory staff, Dr. Alireza Mokhtari and Mr. Abolfazl Moghadam for their valuable assistance in Laboratory studies of this work.

References

1. Zafer MM, Al-Agamy MH, El-Mahallawy HA, Amin MA, Ashour MS. Antimicrobial resistance pattern and their beta-lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients. Biomed Res Int. 2014. doi:10.1155/2014/101635. [Crossref]
2. Carmeli YN, Troillet G, Eliopoulos GM, Samore MH. Emergence of antibiotic-resistant Pseudomonas aeruginosa: comparison of risks associated with different antipseudomonal agents. Antimicrob Agents Chemother 1999;43(6):1379–1382.
3. Carmeli YN, Eliopoulos GM, Samore MH. Antecedent treatment with different antibiotic agents. Emerg Infect Dis 2002;8(2):802–807.
4. Ozgumus OB, Caylan R, Tosun I, Sandalli C, Aydin K, Koksal I. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carryigng the IMP-1 Metallo- β-Lactamase Gene in a University Hospital in Turkey. Microb Drug Resist 2007;13(3):191-198. doi:10.1089/mdr.2007.748. [Crossref]
5. Sykes RB, Mattew M. The b-lactamases of gram-negative bacteria and their role in resistance to b-lactam antibiotics. J Antimicrob Chemother 1976;2(2):115–157. doi :10.1093/jac/2.2.115. [Crossref]
6. Sacha P, Wieczorek P, Hauschild T, Zórawski M, Olszańska D, Tryniszewska E. Metallo beta lactamases of Pseudomonas aeruginosa A novel mechanism resistance to beta lactam antibiotics. Folia Histochem Cytobiol 2008;46(2):137 142. doi:10.2478/v10042-008-0020-9. [Crossref]
7. Ryoo Nam Hee, Ha Jung Sook, Jeon Dong Seok, Kim Jae Ryong. Prevalence of Metallo-β-lactamases in Imipenem-non-suscep­tible Pseudomonas aeruginosa and Acinetobacter baumannii. Korean J Clin Microbiol 2010;13(4):169-72. doi:10.5145/KJCM.2010.13.4.169. [Crossref]
8. Cornaglia G, Mazzariol A, Lauretti L, Rossolini GM, Fontana R. Hospital outbreak of carbapenem-resistant Pseudomonas aeruginosa producingVIM-1, a novel transferable metallo-𝛽-lactamase. Clin Infect Dis 2000; 31(5):1119–1125. doi:10.1086/317448. [Crossref]
9. Yatsuyanagi J, Saito S, Harata S, et al. Class 1 integron containing metallo-𝛽-lactamase gene bla VIM-2 in Pseudomonas aeruginosa clinical strains isolated in Japan. Antimicrob Agents Chemother 2004;48(2):626-628. doi:10.1128/AAC.48.2.626-628.2004. [Crossref]
10. Saderi H, Karimi Z, Owlia P, Bahar A, Akhavi Rad SMB. Phenotypic detection of metallo-beta-lactamaseproducing Pseudomonas aeruginosa strain isolated from burned Patients. Iran J Pathol 2008;3(1):20-24.
11. ArakawaY, ShibataN, Shibayama K, et al. Convenient test for screening metallo-𝛽-lactamase-producing gram- negative bacteria by using thiol compounds. J Clin Microbiol 2000;38(1):40-43.
12. Pitout JDD, Gregson DB, Poirel L, McClure J-A, Le P, Church DL. Detection of Pseudomonas aeruginosa producing metallo-𝛽-lactamases in a large centralized laboratory. J Clin Microbiol 2005;43(7):3129-3135.
13. Moosavian M, Rahimzadeh M. Molecular detection of metallo-β-lactamase genes, blaIMP-1, blaVIM-2 and blaSPM-1 in imipenem resistant Pseudomonas aeruginosa isolated from clinical specimens in teaching hospitals of Ahvaz, Iran. Iran J Microbiol 2015;7(1):2-6.
14. CLSI. Performance standards for antimicrobial susceptibility testing. http://shop.clsi.org/site/Sample_pdf/M100S25_sample.pdf. Published 2007.
15. Franco MRG, Caiaffa-Filho HH, Burattini MN, Rossi F. Metallo-beta-lactamases among imipenem-resistant Pseudomonas aeruginosa in a brazilian university hospital. Clincs 2010;65(9):825-829. doi:10.1590/S1807-59322010000900002. [Crossref]
16. Sepehriseresht S, Boroumand MA, Pourgholi L, Sotoudeh Anvari M, Habibi E, Sattarzadeh Tabrizi M. Detection of vim- and ipm-type metallo-beta-lactamases in Pseudomonas aeruginosa clinical isolates. Arch Iran Med 2012;15(11):670-673. doi: 0121511/AIM.005. [Crossref]
17. Farajzadeh Sheikh A, Rostami S, Jolodar A, et al. Detection of metallo-beta lactamases among carbapenem-resistant Pseudomonas aeruginosa. Jundishapur J Microbiol 2014;7(11):e12289. doi:10.5812/jjm.12289. [Crossref]
18. Kalantar E, Torabi V, Salimizand H, Soheili F, Beiranvand S, Soltan Dallal MM. First Survey of metallo-β–lactamase producers in clinical isolates of Pseudomonas aeruginosa from a referral burn center in Kurdistan province. Jundishapur J Nat Pharm Prod 2012;7(1):23-26.
19. Sarhangi M, Motamedifar M, Sarvari J. Dissemination of Pseudomonas aeruginosa Producing blaIMP1, blaVIM2, blaSIM1, blaSPM1 in Shiraz, Iran. Jundishapur J Microbiol 2013;6(7):e6920. doi:10.5812/jjm.6920. [Crossref]
20. Aghamiri S, Amirmozafari N, Fallah Mehrabadi J, Fouladtan B, Samadi Kafil H. Antibiotic resistance pattern and evaluation of metallo-beta lactamase genes including bla-IMP and bla-VIM types in Pseudomonas aeruginosa isolated from patients in Tehran hospitals. ISRN Microbiol 2014;2014: 941507. doi:10.1155/2014/941507. [Crossref]
21. Doosti M, Ramazani A, Garshasbi M. Identification and characterization of metallo-β-lactamases producing Pseudomonas aeruginosa clinical isolates in university hospital from Zanjan province, Iran. Iran Biomed J 2013;17(3):129-133. doi:10.6091/ibj.1107.2013. [Crossref]
22. Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-beta-lactamase-producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiol 2010;33(3):243-248.
23. Yan JJ, Hsueh PR, Ko WC, Luh KT, Tsai SH, Wu HM. Metallo-β-lactamase in clinical Isolates of Pseudomonas isolates in Taiwan and identification of VIM-3, a novel variant of the VIM2 enzyme. Antimicrob Agents Chemother 2001;45(8): 2224-2228. doi:10.1128/AAC.45.8.2224-2228.2001. [Crossref]
24. Yastuyanagi J, Saito S, Harata S, et al. Class 1 integron containing metallo-beta-lactamase gene blaVIM-2 in Pseudomonas aeruginosa clinical strains isolated in Japan. Antimicrob Agents Chemother 2004;48(2):626-628. doi:10.1128/AAC.48.2.626-628.2004. [Crossref]
25. Stratevat T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol 2009;58(Pt 9):1133-48. doi:10.1099/jmm.0.009142-0. [Crossref]
26. Khosravi AD, Mihani F. Detection of metallo-beta-lactamase-producing Pseudomonas aeruginosa strains isolated from burn patients in Ahwaz, Iran. Diagn Microbiol Infect Dis 2008;60(1):125-128.
27. Lin KY, Lauderdale TL, Wang JT, Chang SC. Carbapenem-resistant Pseudomonas aeruginosa in Taiwan: prevalence, risk factors, and impact on outcome of infections. J Microbiol Immunol Infect 2016;49(1):52-9. doi:10.1016/j.jmii.2014.01.005. [Crossref]
28. Lee K, Park AJ, Kim MY, et al. Metallo-beta-lactamase-producing Pseudomonas spp. in Korea: high preva­lence of isolates with VIM-2 type and emergence of isolates with IMP-1 type. Yonsei Med J 2009;50(3):335-339. doi:10.3349/ymj.2009.50.3.335. [Crossref]
29. Sader H, Reis A, Silbert S, Gales A. IMPs, VIMs and SPMs: the diversity of metallo-beta-lactamases produced by carbapenem resistant Pseudomonas aeruginosa in a Brazilian hospital. Clin Microbiol Infect 2005;11(1):73-76.doi:10.1111/j.1469-0691.2005.01249. [Crossref]
30. Picão R, Poirel L, Gales AC, Nordmann P. Diversity of beta-lactamases produced causing bloodstream infections in Brazil. Antimicrob Agents Chemother 2009;53(9):3908-3913. doi:10.1128/AAC.00453-09. [Crossref]
31. Gales AC, Menezes LC, Silbert S, Sader HS. Dissemination in distinct Brazilian regions of an epidemic carbapenemresistant Pseudomonas aeruginosa producing SPM metallo-beta-lactamase. J Antimicrob Chemother 2003;52(4):699-702.
32. Martins AF, Zavascki AP, Gaspareto PB, Barth AL. Dissemination of Pseudomonas aeruginosa producing SPM-1-like and IMP-1-like metallo-beta-lactamases in hospitals from southern Brazil. Infection 2007;35(6):457-460. doi:10.1007/s15010-007-6289-3. [Crossref]
33. Zavascki AP, Barth AL, Gonçalves AL, et al. The influence of metallo-beta-lactamase production on mortality in nosocomial Pseudomonas aeruginosa infections. J Antimicrob Chemother 2006;58(2):387-92. doi:10.1093/jac/dkl239. [Crossref]
34. Graf T, Fuentefria D, Corcao G. Occurrence of multiresistant strains of Pseudomonas aeruginosa producing metallo- beta-lactamase bla SPM-1 in clinical samples. Rev Soc Bras Med Trop 2008;41(3):306-308. doi:10.1590/S0037-86822008000300017. [Crossref]
35. Ghamgosha M, Shahrekizahedani S, Kafilzadeh F, Bameri Z, Taheri RA, Farnoosh G. Metallo-beta-lactamase VIM-1, SPM-1, and IMP-1 genes among clinical Pseudomonas aeruginosa species isolated in Zahedan, Iran. Jundishapur J Microbiol 2015;8(4):e17489. doi:10.5812/jjm.8(4)2015.17489. [Crossref]
36. Livermore D. Beta-Lactamases in laboratory and clinical resistance. Clin Microbiol Rev 1995;8(4):557-584.
37. Lee YC, Ahn BJ, Jin JS, et al. Molecular characterization of Pseudomonas aeruginosa isolates resistant to all antimicrobial agents, but susceptible to colistin, in Daegu, Korea. J Microbiol 2007;45(4):358-63.
38. Doi Y, Ghilardi A, Adams J, Oliveira Garcia D, Paterson DL. High prevalence of metallobeta- lactamase and 16S rRNA methylase coproduction among imipenem-resistant Pseudomonas aeruginosa isolates in Brazil. Antimicrob Agents Chemother 2007;51(9):3388–3390. doi:10.1128/AAC.00443-07. [Crossref]
39. Bonomo R, Szabo D. Mechanisms of multidrug resistance in Acinetobacter species and Pseudomonas aeruginosa. Clin Infect Dis 2006;43(2):S49-S56. doi:10.1086/504477. [Crossref]